Creating an artificial DNA fragment (Dimer)
by A. Untergasser (contact address and download at
www.untergasser.de/lab)
Version: 1.0 - Print
Version (.PDF)
This Protocol will guide you how to make a completely artificial DNA sequence and how to clone it into a vector. With this method sequences can be made up to 80 bp, it is only limited by the length of the primers you are able to order. It is a great method to create a multiple cloning site with the order of restriction enzymes as you want them!
The general concept is simple: A small artificial DNA fragment is cloned into a vector of choice. These vector needs to have two different restriction enzymes allowing to cut it leaving different sticky ends on both sides. For the artificial DNA fragment two primers are used, one for the forward strain and one for the reverse. They will be mixed and let bind to each other to form the double strain DNA. Because they are made with a just a little overhang, they can directly bind to the restriction sites. DNA fragments are synthesized in a way that they already digested!
- Find a suitable vector you want to use and identify the two restriction enzymes to use
- Primer design: Write down the sequence of the restriction sites
- Alternatively, you can choose if you would 
      like to destroy them.
  
 Therefore, delete one nucleotide closest to your artificial sequence of each restriction side. Take care that you artificial sequence does not start with it!
- Make up your artificial sequence
- Insert it between the two restriction sites
- Reverse complement it
- This are the two primers, trim them to simulate digestion
- Test the result by aligning them in a cloning program
- Order the primers
- Digest the vector using the two restriction enzymes, do not use CIP or SIP to remove phoshates.
- Purify the vector using a gel.
- Dilute the primers to a 100 µM concentration
- Prepare in an Eppi the reaction mix
  
 Forward Primer (100 µM) 20 µl Reverse Primer (100 µM) 20 µl 5 M NaCl-Solution 20 µl Water 20 µl 
- Heat to 95 °C for 10 min
- Let slowly cool to room temperature
- Dilute the solution 1:100 and 1:1000 and use it as Insert in a ligation reaction.
- Sequence all clones to be sure there are no synthesis errors in your artificial sequence
Commented Protocol:
1. Find a suitable vector you want to use and identify the two restriction enzymes to use
For example: Kpn I and Hind III
2. Primer design: Write down the sequence of the restriction sites
For example: GGTACC AAGCTT
3. Alternatively, you can choose if you would like to destroy them.
Therefore, delete one nucleotide closest 
      to your artificial sequence of each restriction side. Take 
      care that you artificial sequence does not start with it!
For example: GGTAC[ATG] [TCG]AGCTT
      The sequence must start with one of the nucleotides 
      in the brackets, otherwise add an additional nucleotide.
      In the following example we leave the sites intact!
    
4. Make up your artificial sequence
For example: GCGGCCGCCTGCAGGAATTC
      (some restriction sites)
    
5. Insert it between the two restriction sites
For example: GGTACCGCGGCCGCCTGCAGGAATTCAAGCTT
6. Reverse complement it
For example: AAGCTTGAATTCCTGCAGGCGGCCGCGGTACC
7. This are the two primers, trim them to simulate digestion
For example: 
      Forward:
      CGCGGCCGCCTGCAGGAATTCA
      
      Reverse:
      AGCTTGAATTCCTGCAGGCGGCCGCGGTAC
    
8. Test the result by aligning them in a cloning program
For example:
                 CGCGGCCGCCTGCAGGAATTCA
      CATGGCGCCGGCGGACGTCCTTAAGTTCGT
    
9. Order the primers
Order high quality to have only few primers containing errors.
10. Digest the vector using the two restriction enzymes, do not use CIP or SIP to remove phoshates.
Primers do not have a 5' phosphate. If you cip the vector, the ligation will not work.
11. Purify the vector using a gel.
Important to get rid of undigested vector.
12. Dilute the primers to a 100 µM concentration
Usually they are delivered in this concentration.
13. Prepare in an Eppi the reaction mix
| Forward Primer (100 µM) | 20 µl | 
| Reverse Primer (100 µM) | 20 µl | 
| 5 M NaCl-Solution | 20 µl | 
| Water | 20 µl | 
14. Heat to 95 °C for 10 min
Use a heat block or PCR machine.
15. Let slowly cool to room temperature
Can be done by packing the Eppi in aluminium foil and leave it to cool down for 15 min.
16. Dilute the solution 1:100 and 1:1000 and use it as Insert in a ligation reaction.
Usually I only make one dilution 1:200 and it always worked.
17. Sequence all clones to be sure there are no synthesis errors in your artificial sequence
Strangely I have never had an error, but it is better to check always.
References and Comments:
I learned this protocol in H. Schallers Lab and used it since then many times. It really works well.
How to cite this page in publications:
This document can be cited like this:
    
    Untergasser A. “Creating an artificial DNA fragment (Dimer)” 
    Untergasser's Lab. Summer 2008. (include here
    the date when you accessed these page).
    <http://www.untergasser.de/lab/protocols/artificial_dna_fragments_v1_0.htm>.
  
Please Do Not Reprint This Article:
This article is copyrighted. Please do not reproduce this article in whole or part, in any form, without obtaining my written permission.